spots
 
Ares lab Yeast Intron Database
Version 3.0
Created and maintained by Leslie Grate, Angela Telerski, Tyson Clark, Ross Centers and Manny Ares

Departments of Molecular, Cell & Developmental Biology and Computer Science in the Division of Natural Sciences and the Jack Baskin School of Engineering, University of California, Santa Cruz, CA  95064
Supported by the W. M. Keck Foundation, the Packard Foundation, and the National Institutes of Health.
Yeast Spliceosomal Introns

Intron Table

Extras

Links

Update History

Acknowledgments



University of California, 
Santa Cruz

Ares Lab Home

MCD Graduate Program

RNA Center

Computational Biology

Center for Biomolecular Engineering

Microarray Facility



TABLE 2. PRIMING SITES OF THE REPEATED Y' ELEMENT PRIMERS

Primer pairs for the repeated Y' elements amplify sequences from multiple genomic sites.  These primers are also available.
 
Model Y' element ORF Upstream primer sequence Priming sites for upstream primer Priming sites for downstream primer Downstream primer sequence Comments??
YEL076C-A gcggatccaaaacactagatgccgtg
5162 5147 chr10
1066887 1066902 chr12
1073471 1073486 chr12
4790 4775 chr14
1086433 1086448 chr15
4699 4684 chr16
1527285 1527300 chr4
4794 4779 chr5
572102 572117 chr5
1086168 1086183 chr7
5179 5164 chr9
4511 4526 chr10
1067458 1067443 chr12
1074121 1074106 chr12
4140 4155 chr14
1087083 1087068 chr15
4049 4064 chr16
1527935 1527920 chr4
4223 4238 chr5
572752 572737 chr5
1086818 1086803 chr7
4528 4543 chr9
cggtcgaccagtgtgcagttggatgc Annotated intron is same as that for YLR464W. Intron is predicted to be 279 nt long starting at nt 514 of the ORF and ending at 792. Evidence for unspliced RNA was obtained.
YJL225C gcggatccctataccacgaagtagcgcag
5045 5030 chr10
1067004 1067019 chr12
1073588 1073603 chr12
4673 4658 chr14
1086550 1086565 chr15
4582 4567 chr16
1527402 1527417 chr4
4677 4662 chr5
572219 572234 chr5
1086285 1086300 chr7
5062 5047 chr9
4480 4495 chr10
1074152 1074137 chr12
1067489 1067474 chr12
4109 4124 chr14
1087114 1087099 chr15
4018 4033 chr16
1527966 1527951 chr4
4192 4207 chr5
572783 572768 chr5
1086849 1086834 chr7
4497 4512 chr9
cgtagtcgacagtcgaggctccgatgaaccg Annotated intron is same as that for YIL177C. Intron is predicted to be 388 nt long starting at nt 1162 of the ORF and ending at 1549. Evidence for unspliced RNA was obtained.
YNL339C gcggatcccaagagaatatccacgaagcg
6549 6534 chr10
5221 5206 chr12
10756 10741 chr12
1065556 1065571 chr12
1072089 1072104 chr12
5097 5082 chr13
6177 6162 chr14
1085051 1085066 chr15
6086 6071 chr16
942948 942963 chr16
5433 5418 chr2
1525903 1525918 chr4
570756 570771 chr5
6108 6093 chr5
1084781 1084796 chr7
557394 557409 chr8
6566 6551 chr9
6170 6185 chr10
4848 4863 chr12
10383 10398 chr12
1065911 1065896 chr12
1072463 1072448 chr12
4724 4739 chr13
5798 5813 chr14
1085425 1085410 chr15
5707 5722 chr16
943327 943312 chr16
5049 5064 chr2
1526277 1526262 chr4
5753 5768 chr5
571111 571096 chr5
1085160 1085145 chr7
557778 557763 chr8
6187 6202 chr9
cgggtacctgttgattgttatgctttttg Annotated intron is same as that for YGR296W, YPL283C, and YPR202W. Intron is predicted to be 148 nt long starting at nt 20 of the ORF and ending at 167. Evidence for unspliced RNA was obtained.
YPR202W gcggatccatggaaattgaaaacgaa
6468 6453 chr10
5140 5125 chr12
10675 10660 chr12
1065637 1065652 chr12
1072170 1072185 chr12
5016 5001 chr13
6096 6081 chr14
1085132 1085147 chr15
6005 5990 chr16
943029 943044 chr16
5352 5337 chr2
1525984 1525999 chr4
6027 6012 chr5
570837 570852 chr5
4184 4169 chr6
1084862 1084877 chr7
4873 4858 chr8
557475 557490 chr8
6485 6470 chr9
6164 6179 chr10
4842 4857 chr12
10377 10392 chr12
1065917 1065902 chr12
1072469 1072454 chr12
4718 4733 chr13
5792 5807 chr14
1085431 1085416 chr15
5701 5716 chr16
943333 943318 chr16
5043 5058 chr2
1526283 1526268 chr4
5747 5762 chr5
571117 571102 chr5
3880 3895 chr6
1085166 1085151 chr7
4574 4589 chr8
557784 557769 chr8
6181 6196 chr9
cgggtaccatagtatgttgattgttatgc Annotated intron is same as that for YGR296W, YPL283C, and YNL339C. Intron is predicted to be 148 nt long starting at nt 20 of the ORF and ending at 167. Evidence for unspliced RNA was obtained. This primer pair has a 3' primer that overlaps the YNL339C 3' primer, but has a 5' primer about 80 bp closer.

















This RNA webring site owned by Manny Ares.
[ Previous 5 Sites | Previous | Next | Next 5 Sites | Random Site | List Sites ]