SAM Processing Submission Form

How to Use This Form

This is the abbreviated version of the full-featured SAM Processing Submission Form. This version differs in that many choices have been made for you and the whole operation is much more obvious.

An even simpler version which allows you to improve a multiple sequence alignment or align your sequences is also available.

This page currently enables you to:

  1. build a model from sequences that you provide,
  2. create a multiple alignment of sequences to the model, and
  3. score each sequence against the model.
You will receive the model built, the sequence alignment, and the score of each sequence against the model. Because building an HMM uses random noise in training, you may get different results each time you submit a query. If your results are poor, you may wish to try again.

Depending on the size of your query, processing can take seconds to hours.

You may want to consult the online documentation or (view) download a postscript copy. The quick overview is particularly helpful.

E-mail Address (Required) for results:

Sequence Data

Please place your sequences in the following text area(s). The number and character of the sequences that you submit is important. Generally, more is better. For optimal results, we recommend 20-50 dissimilar sequences.

There are two boxes for sequence data. The first, Training Sequences, is for sequences with which to build the model. The second, Database Sequences, are the actual sequences that will be aligned and scored with the model. If there are no sequences in Database Sequences, then those placed in Training Sequences will be used for aligning and scoring.

Sequence format is important. SAM uses D.G. Gilbert's ReadSeq package. Be sure sequences are separated appropriately and that there is a newline at the end of your paste. For example: 

>SEQ1LABEL
ggactagcgaactgggttatttttttgcgc
>SEQ2LABEL
taatgatgtcgaagggattaggggcgcgca

Training Sequences (Multiple Sequences Required)

Use the scroll bar on the right to make more room.


Database Sequences (Optional)

If database sequences are specified, only the database sequences will be aligned and scored.

Email sam-info@cse.ucsc.edu with problems and questions.
UCSC Computational Biology Group

SAM Home Page

sam-info@cse.ucsc.edu

This program is running on an AlphaServer donated in part by