SAM Processing Submission Form

Simple Tuneup Alignment Form and Short Form Available

If you find that this page presents too many options, or your needs don't require the capabilities of this form, try the simple tuneup alignment form or abbreviated SAM Processing Submission Form.

How to Use This Form

This page currently enables you to:
  1. build a model from sequences that you provide,
  2. align sequences to a model (that you provide or was built above),
  3. multiply align a sequence to a model,
  4. and generate the score of each sequence for the model.
Complete the entire "Processes to Perform" section. This is the first box below. If you request that the sequences be aligned to a model that you are supplying, you must indicate so. (NOTE: Model and sequence data can be supplied by using cut-and-paste methods.)

Documentation

From here you may view current online documentation or (view) download a postscript copy.

Processes to Perform

Operations to be Performed (check all that apply)
buildmodel yes no This data back yes no


The results of any of the following operations that you choose will be sent to you:
align2model yes no
multdomain yes no
hmmscore yes no


Have you supplied your own model for align2model, multdomain, and hmmscore? yes no
Address to which results ought to be sent:

Sequence Data

Please place your sequences in the following text area(s). The number and character of the sequences that you submit is important. Generally, more is better. For optimal results, we recommend 20-50 dissimilar sequences.

There are two boxes for sequence data. The first, Training Sequences, is for sequences with which to build the model. The second, Database Sequences, are the actual sequences that will be aligned and scored with the model. If there are no sequences in Database Sequences, then those placed in Training Sequences will be used for aligning and scoring.

Sequence format is important. SAM uses D.G. Gilbert's ReadSeq package. Be sure sequences are separated appropriately and that there is a newline at the end of your paste. For example: 
>SEQ1LABEL
ggactagcgaactgggttatttttttgcgc
>SEQ2LABEL
taatgatgtcgaagggattaggggcgcgca

Training Sequences



Database Sequences

User Supplied Model

If you're supplying your own model for align2model and hmmscore or/and as the initial model for buildmodel, place it here.

Would you like to use this model as the initial model for the buildmodel process? yes no

Parameter Specifications

For the "Parameter Specifications" section, simply enter the option name without the "-" and the appropriate value. For example, if you want to specify a model length of 75 and a seed of 34 for buildmodel, you would simply type

modellength 75 seed 34


in the box underneath the words "Specify any nondefault buildmodel parameters below."
default parameters
If you would like to receive a listing of all the current default parameter values, click the following box:
buildmodel parameters
Specify any nondefault buildmodel parameters below.
align2model/prettyalign parameters
Use prettyalign? yes no
Specify any nondefault align2model parameters below.
Specify any nondefault prettyalign parameters below.
Unlike the other parameter specification boxes, you must enter any parameters in this box just as you would on the command line.
hmmscore parameters
Specify any nondefault hmmscore parameters below.

Email sam-info@cse.ucsc.edu with problems and questions.
UCSC Computational Biology Group

SAM Home Page

sam-info@cse.ucsc.edu

This program is running on an AlphaServer donated in part by